ID: 989568959_989568966

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 989568959 989568966
Species Human (GRCh38) Human (GRCh38)
Location 5:42927273-42927295 5:42927325-42927347
Sequence CCATGCAGTGGGGAGGCTGGGGG AAATCCCCTTGGCTGAGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 8, 3: 65, 4: 612} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!