ID: 989585481_989585486

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 989585481 989585486
Species Human (GRCh38) Human (GRCh38)
Location 5:43071243-43071265 5:43071288-43071310
Sequence CCCTGGAGCTGTAGGCCAGAGCA GTTAACACGCTGACATCTTTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 35, 4: 315} {0: 1, 1: 0, 2: 0, 3: 10, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!