ID: 989654140_989654144

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 989654140 989654144
Species Human (GRCh38) Human (GRCh38)
Location 5:43726442-43726464 5:43726465-43726487
Sequence CCCATTTTATAGATGTGGAAGCT CAGGGCCCAATTAATTAAGTAGG
Strand - +
Off-target summary {0: 4, 1: 51, 2: 568, 3: 2811, 4: 8488} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!