ID: 989714443_989714446

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 989714443 989714446
Species Human (GRCh38) Human (GRCh38)
Location 5:44444664-44444686 5:44444689-44444711
Sequence CCTACCATATTCAGCATAGTAAC GCTGTATAGGTTTGTAGCCTAGG
Strand - +
Off-target summary No data {0: 48, 1: 610, 2: 1334, 3: 1422, 4: 1186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!