ID: 989956695_989956699

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 989956695 989956699
Species Human (GRCh38) Human (GRCh38)
Location 5:50368511-50368533 5:50368529-50368551
Sequence CCACAAAGGGAAGCCCATCACAC CACACTAACAGCGGATCTCTCGG
Strand - +
Off-target summary No data {0: 13, 1: 1942, 2: 2687, 3: 987, 4: 361}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!