|
Left Crispr |
Right Crispr |
Crispr ID |
989956695 |
989956699 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
5:50368511-50368533
|
5:50368529-50368551
|
Sequence |
CCACAAAGGGAAGCCCATCACAC |
CACACTAACAGCGGATCTCTCGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 13, 1: 1942, 2: 2687, 3: 987, 4: 361} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|