ID: 990259115_990259120

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 990259115 990259120
Species Human (GRCh38) Human (GRCh38)
Location 5:54002245-54002267 5:54002279-54002301
Sequence CCCTTTATCCAAAGATGAATGAA GTCCTCTAAACATTAATGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 388} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!