ID: 990308621_990308640

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 990308621 990308640
Species Human (GRCh38) Human (GRCh38)
Location 5:54517865-54517887 5:54517918-54517940
Sequence CCAGGGCTCGAGCAGTACCGCGG CGGGAGTCGGGACCGCCAGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 171} {0: 1, 1: 0, 2: 0, 3: 0, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!