ID: 990481915_990481920

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 990481915 990481920
Species Human (GRCh38) Human (GRCh38)
Location 5:56220015-56220037 5:56220028-56220050
Sequence CCCAGCTGCCTGCTGCACCGGAG TGCACCGGAGGCTGAGCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 158} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!