ID: 990550741_990550747

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 990550741 990550747
Species Human (GRCh38) Human (GRCh38)
Location 5:56875623-56875645 5:56875653-56875675
Sequence CCTTCCTCATCCTCCTTTTCCAC TAGAGACAGACTAAAAACCATGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 52, 3: 368, 4: 2181} {0: 2, 1: 1, 2: 3, 3: 42, 4: 342}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!