ID: 990877291_990877298

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 990877291 990877298
Species Human (GRCh38) Human (GRCh38)
Location 5:60500023-60500045 5:60500060-60500082
Sequence CCCAGGCTGGGTGTGGTGGCTCA GCACTTAGGGAGATTGAAACAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 28, 3: 894, 4: 13413}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!