ID: 990963405_990963410

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 990963405 990963410
Species Human (GRCh38) Human (GRCh38)
Location 5:61418552-61418574 5:61418593-61418615
Sequence CCCGGCCTACTCTATGATTTTTA GTGACTATCTAGATGAGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 30, 3: 194, 4: 1322} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!