ID: 990963406_990963410

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 990963406 990963410
Species Human (GRCh38) Human (GRCh38)
Location 5:61418553-61418575 5:61418593-61418615
Sequence CCGGCCTACTCTATGATTTTTAT GTGACTATCTAGATGAGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 93, 4: 725} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!