ID: 990977027_990977035

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 990977027 990977035
Species Human (GRCh38) Human (GRCh38)
Location 5:61569350-61569372 5:61569400-61569422
Sequence CCCTGAGCGCTCAGCACTCTGGG CCCAGAGCCAGGCGCCTTCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!