ID: 990988217_990988220

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 990988217 990988220
Species Human (GRCh38) Human (GRCh38)
Location 5:61660646-61660668 5:61660664-61660686
Sequence CCATGGCCAGAGAGGAAGGTAGG GTAGGTCAAACACATATCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 357} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!