ID: 991066870_991066876

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 991066870 991066876
Species Human (GRCh38) Human (GRCh38)
Location 5:62433392-62433414 5:62433431-62433453
Sequence CCAACTGTAGGCACGTTCGTATA GATATACTCTGGGCGCCAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 18} {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!