ID: 991632474_991632479

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 991632474 991632479
Species Human (GRCh38) Human (GRCh38)
Location 5:68670107-68670129 5:68670156-68670178
Sequence CCCACTCCAGACCTGCTGAATCA GTGATACTAATGCACATTAAAGG
Strand - +
Off-target summary {0: 6, 1: 87, 2: 357, 3: 1087, 4: 2185} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!