ID: 991689652_991689661

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 991689652 991689661
Species Human (GRCh38) Human (GRCh38)
Location 5:69213831-69213853 5:69213882-69213904
Sequence CCTTTCTTCTTGCCTATTTCTCC CCTGACCCATCATTGTGTTTTGG
Strand - +
Off-target summary {0: 14, 1: 43, 2: 94, 3: 375, 4: 3043} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!