ID: 991843581_991843586

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 991843581 991843586
Species Human (GRCh38) Human (GRCh38)
Location 5:70833527-70833549 5:70833546-70833568
Sequence CCAAGGCCATGGGAGCCCACCTC CCTCTTGCATTAACATGCCCTGG
Strand - +
Off-target summary No data {0: 3, 1: 7, 2: 107, 3: 780, 4: 1282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!