ID: 992110886_992110888

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 992110886 992110888
Species Human (GRCh38) Human (GRCh38)
Location 5:73492335-73492357 5:73492355-73492377
Sequence CCTTACGGCTGAAGATAGGGTTT TTTAGGATTGCTCCACATGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 38} {0: 1, 1: 0, 2: 0, 3: 4, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!