ID: 992139325_992139333

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 992139325 992139333
Species Human (GRCh38) Human (GRCh38)
Location 5:73780182-73780204 5:73780211-73780233
Sequence CCCAGGGCCAGCCTGCACCAGCG AACCTGCAGCTCAGGGCCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 252} {0: 1, 1: 0, 2: 6, 3: 38, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!