ID: 992139326_992139333

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 992139326 992139333
Species Human (GRCh38) Human (GRCh38)
Location 5:73780183-73780205 5:73780211-73780233
Sequence CCAGGGCCAGCCTGCACCAGCGT AACCTGCAGCTCAGGGCCCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 38, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!