ID: 992331853_992331856

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 992331853 992331856
Species Human (GRCh38) Human (GRCh38)
Location 5:75725189-75725211 5:75725204-75725226
Sequence CCCAGGTCATAGTCTCCATCTTG CCATCTTGTAGCTCACCAGTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!