ID: 992562793_992562795

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 992562793 992562795
Species Human (GRCh38) Human (GRCh38)
Location 5:77968949-77968971 5:77968967-77968989
Sequence CCGAGCATGGTGGCTCATGCCTG GCCTGTAATTCCAGCACTTTGGG
Strand - +
Off-target summary {0: 451, 1: 10455, 2: 44604, 3: 107737, 4: 180085} {0: 8353, 1: 231656, 2: 273926, 3: 181702, 4: 144141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!