ID: 992562799_992562815

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 992562799 992562815
Species Human (GRCh38) Human (GRCh38)
Location 5:77968977-77968999 5:77968996-77969018
Sequence CCAGCACTTTGGGAGACCAGGGG GGGGTTGGGGCGGGGGGGGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!