ID: 992656576_992656585

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 992656576 992656585
Species Human (GRCh38) Human (GRCh38)
Location 5:78916315-78916337 5:78916335-78916357
Sequence CCCTGGCCTGTTCCAGTCCAGAA GAAGAAAGGAGACTGGGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 211} {0: 1, 1: 0, 2: 2, 3: 61, 4: 478}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!