ID: 992656578_992656587

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 992656578 992656587
Species Human (GRCh38) Human (GRCh38)
Location 5:78916321-78916343 5:78916367-78916389
Sequence CCTGTTCCAGTCCAGAAGAAAGG AAACTGTCTTTAGTTTAAAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 39, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!