ID: 992666556_992666561

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 992666556 992666561
Species Human (GRCh38) Human (GRCh38)
Location 5:79015203-79015225 5:79015217-79015239
Sequence CCTCCTCTCACCCCTTCACATGC TTCACATGCAGTCCCTCATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 40, 4: 571} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!