ID: 992758772_992758778

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 992758772 992758778
Species Human (GRCh38) Human (GRCh38)
Location 5:79933424-79933446 5:79933477-79933499
Sequence CCAAATGGCTAGGATTTGATGAA GCTTCCAACTCAGGACCAAACGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!