ID: 992813049_992813062

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 992813049 992813062
Species Human (GRCh38) Human (GRCh38)
Location 5:80408310-80408332 5:80408351-80408373
Sequence CCCCCGGAGCTGGCCGGGGAACC GTCCCCTCCTGGAGCCTGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 137} {0: 1, 1: 0, 2: 0, 3: 20, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!