ID: 992813057_992813069

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 992813057 992813069
Species Human (GRCh38) Human (GRCh38)
Location 5:80408337-80408359 5:80408365-80408387
Sequence CCCTCCAATCTGATGTCCCCTCC CCTGAAGGGCCAGACCGGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 255} {0: 1, 1: 0, 2: 1, 3: 11, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!