ID: 992862810_992862818

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 992862810 992862818
Species Human (GRCh38) Human (GRCh38)
Location 5:80929317-80929339 5:80929365-80929387
Sequence CCAATGGTCCAGGCCTCAGTGGT AATGTGCCACAGATGGAGCTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!