ID: 992877797_992877801

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 992877797 992877801
Species Human (GRCh38) Human (GRCh38)
Location 5:81075144-81075166 5:81075171-81075193
Sequence CCAAGTAAGAGATGATTATAATG CAGTATAAGTAGTTGGATTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 202} {0: 1, 1: 0, 2: 0, 3: 7, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!