ID: 992890092_992890099

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 992890092 992890099
Species Human (GRCh38) Human (GRCh38)
Location 5:81195986-81196008 5:81196029-81196051
Sequence CCGTGGCTCACGCGTGTAACTGC AGGGCAGATCATTTGAAGTCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 9, 3: 200, 4: 3293} {0: 4, 1: 140, 2: 2239, 3: 16072, 4: 50521}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!