ID: 993159931_993159944

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 993159931 993159944
Species Human (GRCh38) Human (GRCh38)
Location 5:84277163-84277185 5:84277199-84277221
Sequence CCCCCCAAGATTCATATGTTGAA AGGCGATGGTATTAAGAGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 35, 2: 329, 3: 1175, 4: 2281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!