|
Left Crispr |
Right Crispr |
Crispr ID |
993159935 |
993159941 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
5:84277167-84277189
|
5:84277195-84277217
|
Sequence |
CCAAGATTCATATGTTGAAATTT |
CCCAAGGCGATGGTATTAAGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 30, 2: 341, 3: 1428, 4: 3312} |
{0: 1, 1: 34, 2: 261, 3: 880, 4: 2085} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|