ID: 993159935_993159943

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 993159935 993159943
Species Human (GRCh38) Human (GRCh38)
Location 5:84277167-84277189 5:84277198-84277220
Sequence CCAAGATTCATATGTTGAAATTT AAGGCGATGGTATTAAGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 30, 2: 341, 3: 1428, 4: 3312} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!