ID: 993159935_993159946

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 993159935 993159946
Species Human (GRCh38) Human (GRCh38)
Location 5:84277167-84277189 5:84277208-84277230
Sequence CCAAGATTCATATGTTGAAATTT TATTAAGAGGTGGGGCTTTTAGG
Strand - +
Off-target summary {0: 1, 1: 30, 2: 341, 3: 1428, 4: 3312} {0: 17, 1: 238, 2: 943, 3: 2010, 4: 3170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!