ID: 993203393_993203397

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 993203393 993203397
Species Human (GRCh38) Human (GRCh38)
Location 5:84847539-84847561 5:84847580-84847602
Sequence CCTTTGGATAAATAGCTCTTGAC GGAAACTGAACATTTGACTATGG
Strand - +
Off-target summary No data {0: 53, 1: 132, 2: 165, 3: 111, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!