ID: 993203393_993203398

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 993203393 993203398
Species Human (GRCh38) Human (GRCh38)
Location 5:84847539-84847561 5:84847581-84847603
Sequence CCTTTGGATAAATAGCTCTTGAC GAAACTGAACATTTGACTATGGG
Strand - +
Off-target summary No data {0: 60, 1: 133, 2: 160, 3: 122, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!