ID: 993248789_993248794

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 993248789 993248794
Species Human (GRCh38) Human (GRCh38)
Location 5:85487644-85487666 5:85487685-85487707
Sequence CCTTCACTCTTCTGGAAGGGCAT TCCATGGTTTGGAATAAAAGAGG
Strand - +
Off-target summary No data {0: 8, 1: 29, 2: 32, 3: 52, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!