ID: 993250040_993250044

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 993250040 993250044
Species Human (GRCh38) Human (GRCh38)
Location 5:85510081-85510103 5:85510110-85510132
Sequence CCTTTCCTGATTTTGGTATTAGG CTGTTTTCATAGAATGAATTAGG
Strand - +
Off-target summary {0: 34, 1: 504, 2: 695, 3: 566, 4: 897} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!