ID: 993261124_993261126

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 993261124 993261126
Species Human (GRCh38) Human (GRCh38)
Location 5:85659242-85659264 5:85659259-85659281
Sequence CCAAGTTGTTTGTATCCTCTTTT TCTTTTATTTCCTTGAGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 35, 2: 47, 3: 130, 4: 539} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!