ID: 993308981_993308988

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 993308981 993308988
Species Human (GRCh38) Human (GRCh38)
Location 5:86304403-86304425 5:86304428-86304450
Sequence CCCAAGGAGGGAGGATTCCTTGA CCAGGAGTTTGAGATCAGACGGG
Strand - +
Off-target summary No data {0: 30, 1: 2118, 2: 28031, 3: 98215, 4: 165417}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!