ID: 993373431_993373434

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 993373431 993373434
Species Human (GRCh38) Human (GRCh38)
Location 5:87119830-87119852 5:87119847-87119869
Sequence CCACTTGGGAGGCACTGCTGGGA CTGGGAAAGACATCCTAGGTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!