ID: 993395597_993395598

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 993395597 993395598
Species Human (GRCh38) Human (GRCh38)
Location 5:87383232-87383254 5:87383250-87383272
Sequence CCAACTTAGGCTGTTCTGTTTAA TTTAAATAAATTAAGAAATGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 20, 3: 200, 4: 1779}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!