ID: 993462728_993462737

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 993462728 993462737
Species Human (GRCh38) Human (GRCh38)
Location 5:88204412-88204434 5:88204465-88204487
Sequence CCACCACCAAATGCTTTAAATGT CTGGGTAAACCATCGGATGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 110, 4: 2560} {0: 1, 1: 0, 2: 0, 3: 2, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!