ID: 993858567_993858576

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 993858567 993858576
Species Human (GRCh38) Human (GRCh38)
Location 5:93105458-93105480 5:93105499-93105521
Sequence CCCCACATTCATTAGGTATTTGT CAAGTTTGTCTGACTCAGGCAGG
Strand - +
Off-target summary {0: 11, 1: 548, 2: 1095, 3: 1541, 4: 1660} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!