ID: 993858568_993858576

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 993858568 993858576
Species Human (GRCh38) Human (GRCh38)
Location 5:93105459-93105481 5:93105499-93105521
Sequence CCCACATTCATTAGGTATTTGTC CAAGTTTGTCTGACTCAGGCAGG
Strand - +
Off-target summary {0: 11, 1: 581, 2: 1592, 3: 1687, 4: 1984} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!