ID: 993978866_993978873

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 993978866 993978873
Species Human (GRCh38) Human (GRCh38)
Location 5:94516955-94516977 5:94516987-94517009
Sequence CCGGGCATGGTAGTGCATGCCTG CTACTTAGGAGGCCTGAGGCAGG
Strand - +
Off-target summary No data {0: 2, 1: 41, 2: 209, 3: 756, 4: 2128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!