ID: 993992442_993992445

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 993992442 993992445
Species Human (GRCh38) Human (GRCh38)
Location 5:94676333-94676355 5:94676366-94676388
Sequence CCTGCAGTGTTTTCTGGAGACTA CTAGTCCTGCCGATCACACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 176} {0: 1, 1: 0, 2: 0, 3: 2, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!